Skip to content

Replikacja wirusa zapalenia wątroby typu C.

4 miesiące ago

1010 words

Farci i in. (Wydanie z 11 lipca) przedstawił dane dotyczące zmian w czasie na poziomach RNA wirusa zapalenia wątroby typu C (HCV) u pacjentów z niedotlenionym zapaleniem wątroby po transfuzji nie-A i bez zakażenia oraz u eksperymentalnie zakażonych szympansów. Autorzy wyciągnęli szereg interesujących wniosków dotyczących schematów zakażenia HCV i możliwej wartości klinicznej reakcji łańcuchowej polimerazy (PCR) w klasyfikowaniu potencjalnie zakażonych osób według tych, których zakażenie ustąpiło, u osób z przetrwałym zakażeniem oraz u osób z czynną infekcją. Większość ich wniosków jest jednoznaczna, ale obawiamy się, że wpływ manipulacji i przechowywania próbek na stabilność, a tym samym na wykrywalność HCV RNA, może podważyć szereg obserwacji.
Niedawno zakończyliśmy badanie stabilności RNA HCV (dane niepublikowane). Używając czułego testu PCR skierowanego na wysoce konserwatywny region 5 nieulegającego translacji genomu HCV (Cha TA i in., Dane niepublikowane), porównywano szybkość wykrywania HCV RNA w surowicy testowej donora poddanej rutynowym badaniom przesiewowym i dodatkowym testom ( wymagające okresów przechowywania w temperaturze pokojowej i kilku cyklach zamrażania i rozmrażania) i odpowiadające im świeże mrożone osocze z 27 próbek reaktywnych wobec anty-HCV w teście immunoenzymatycznym. Wykryliśmy HCV RNA we wszystkich 16 próbkach świeżo mrożonego osocza, które były anty-HCV-dodatnie w testach suplementacyjnych (tylko 2 z nich miały podwyższony poziom aminotransferazy alaninowej), ale tylko w 10 (62,5 procent) próbek surowicy. Przeprowadziliśmy także kontrolowane, półilościowe oceny HCV RNA na próbkach surowicy i osocza po przechowywaniu w temperaturze pokojowej, w temperaturze 4 ° C, w temperaturze -80 ° C i po jednym do trzech cyklach zamrażania i rozmrażania. Długotrwałe przechowywanie w temperaturze pokojowej powodowało zmniejszenie wykrywalnych stężeń HCV RNA o więcej niż 3 log, podczas gdy zamrażanie i rozmrażanie powodowało zmniejszenie o połowę log. Błąd Farci i wsp. zidentyfikowanie przetrwałego HCV RNA u jednego seropozytywnego biorcy (Pacjent 4) i jednego szympansa (189) mogło wynikać z braku jednolitego przechowywania i traktowania ich seryjnych próbek zamiast rzeczywistego usuwania wirusa. W związku z tym ich wnioski, że utrzymywanie się przeciwciał nie zawsze korelują z obecnością infekcji i że klirens RNA HCV koreluje z ustąpieniem choroby [zakażeniem] może być przedwczesne. Podobnie, nieadekwatna dbałość o równomierne manipulowanie i przechowywanie próbek mogło doprowadzić do obserwacji Garson i wsp., 2, którzy zgłaszali przerywany fluktuacyjny sygnał PCR HCV (przypisywany sporadycznej wiremii) w surowicy pacjentów z hemofilią, którzy byli badani podłużnie. Uważamy, że przyszłe badania dotyczące naturalnego przebiegu zakażenia HCV (i innych czynników wirusowych RNA, takich jak ludzki wirus upośledzenia odporności), które wykorzystują półilościową analizę RNA RNA w surowicy lub ekstraktach z osocza, muszą dokładnie kontrolować wpływ obchodzenia się z próbkami i przechowywania ich na organizm. zapewnić dokładną interpretację wyników.
Michael P. Busch, MD, Ph.D.
Irwin Memorial Blood Centers, San Francisco, CA94118
Judith C. Wilber, Ph.D.
Chiron Corporation, Emeryville, CA 94608
2 Referencje1 Farci P, Alter HJ, Wong D i in. . Długoterminowe badanie replikacji wirusa zapalenia wątroby typu C w wirusowym zapaleniu wątroby typu non-A. N Engl J Med 1991; 325: 98-104.
Full Text Web of Science MedlineGoogle Scholar
2. GarsonJA, Tuke PW, Makris M, i in. . Wykazanie wzorców wiremii u chorych na hemofilię leczonych koncentratami czynnika VIII zanieczyszczonymi wirusem zapalenia wątroby typu C Lancet 1990; 336: 1022-5.
Crossref Web of Science MedlineGoogle Scholar
Farci i in. wykazali, że HCV jest okresowo nieobecny w surowicy pacjentów z przewlekłym zakażeniem HCV. W tym czasie RNA HCV może być obecne w tkance wątroby. Jednak w badaniach retrospektywnych jedyną dostępną zwykle tkankę wątroby uzyskano przez biopsję i zazwyczaj utrwalano ją w formaldehydzie i zatapiano w parafinie. W związku z tym chcieliśmy opracować metodę wykrywania HCV RNA w utrwalonej tkance wątrobowej zatopionej w parafinie.
Badaniom poddano osiem próbek tkanki wątrobowej utrwalonych w formaldehydzie i zatopionych w parafinie. Materiały otrzymano z eksplantowanych wątróbek pacjentów poddanych ortotopowemu przeszczepowi wątroby. Pięciu pacjentów miało zakażenia HCV, jak ustalono przez wykrycie przeciwciał przeciwko HCV i wirusowemu RNA w surowicy. Tkanki wątroby od trzech pacjentów z pierwotną marskością żółciową zastosowano jako kontrole. Żaden z tych trzech pacjentów nie otrzymał produktów krwiopochodnych.
W skrócie, RNA wyekstrahowano z tkanki wątroby zgodnie z metodą Jackson et al.1. Osiem 10-.m wycinków z każdego bloku pocięto i umieszczono w jałowych plastikowych probówkach. Próbki odparafinowano w ksylenie, dalej traktowano 100% etanolem, ponownie uwodniono 70% etanolem i wysuszono. Peletki ponownie zawieszono w roztworze złożonym z 10 mmoli kwasu TRIS-chlorowodorowego na litr (pH 7,5), 100 mmol chlorku sodu na litr i mmol EDTA na litr, a białka strawiono proteinazą K (0,5 mg na mililitr ) w obecności 3% dodecylosiarczanu sodu przez dwa dni. Kwasy nukleinowe ekstrahowano fenolem i chloroformem, a następnie strącano etanolem.
Antysensowny starter oligonukleotydowy (5 CTGGTGACAGCAGCTGTAA3 ) odpowiadający pozycjom 5696 do 5715 opublikowanej sekwencji HCV2 został zsyntetyzowany i zastosowany do odwrotnej transkrypcji. Amplifikację przeprowadzono zgodnie ze sposobem Saiki i wsp.3 przy użyciu sensownego primera 5 GGCTGTGCTTGGTATGAG3 , znajdującego się w pozycjach 4889 do 4906. Po 35 cyklach 5 .l amplifikowanej mieszaniny przeniesiono do innej probówki i drugą amplifikację. etap z wewnętrznymi starterami (antysensowny primer 5 TCCGCTTGCTTGGTGGCTGTTTGC3 , zlokalizowany w pozycjach od 5527 do 5550 i sensowny primer 5 ACTTCTTGTCCCAGACCAAGCAGG-3 , zlokalizowany w pozycjach od 5031 do 5054).
Ryc. 1. Ryc. 1. Wykrywanie sekwencji HCV za pomocą zagnieżdżonego PCR w tkankach wątroby o stałej HCV. Produkty PCR próbek wątroby od pacjentów kontrolnych z pierwotną marskością żółciową przedstawiono na ścieżkach od do 3 oraz od pacjentów z zakażeniem HCV w ścieżkach 4 do 8. MW oznacza masę cząsteczkową.
Produkty PCR rozdzielono na 1% żelu agarozowym. Jak pokazano na rysunku 1, wykryto pasmo 519 par zasad (bp) we wszystkich próbkach wątroby od pacjentów zakażonych HCV, ale nie u pacjentów z grupy kontrolnej W celu potwierdzenia specyficzności tego podejścia przeprowadzono analizę Southern blot z fragmentem BanII-AvaI znakowanym radioaktywnie, znajdującym się w pozycjach od 5132 do 5538 sekwencji Chiron. We wszystkich tkankach wątroby pacjentów zakażonych HCV komplementarna sonda DNA hybrydyzowała z pasmem 519-bp. Pasma tego nie zaobse
[przypisy: anr suwałki, teleplan bydgoszcz, ibufen dla dzieci ]

0 thoughts on “Replikacja wirusa zapalenia wątroby typu C.”